Quick Taq® HS DyeMix
A Taq-based 2× master mix for hot start PCR with built-in bromophenol blue (BPB) loading dye — load amplified products directly onto agarose or acrylamide gels.
Shipping notice. This product has ICE or DRY ICE shipping requirements, DO NOT select Ground Shipping.
$1.00 is only for sample (please inquire)
Ordering
100 rxn, 50 µl per reaction. Cat No. list below.
| Product Name | Cat No. | Size | Storage | Order |
|---|---|---|---|---|
| Quick Taq™ HS DyeMix, Trial | TYB-DTM-101S | 1.25ml | Store at -20 °C ( 4 °C for a month ) | Order |
| Quick Taq™ HS DyeMix, 1 pack | TYB-DTM-101 | 2 x 1.25ml | Store at -20 °C ( 4 °C for a month ) | Current page |
| Quick Taq™ HS DyeMix, 5 pack | TYB-DTM-101-5PK | (2 x 1.25ml) X 5 | Store at -20 °C ( 4 °C for a month ) | Order |
| Quick Taq™ HS DyeMix, 10 pack | TYB-DTM-101-10PK | (2 x 1.25ml) X 10 | Store at -20 °C ( 4 °C for a month ) | Order |
Description
Quick Taq® HS DyeMix is a Taq-based 2x master mix PCR reagent that contains an electrophoresis dye (BPB; bromophenol blue) and anti-Taq antibodies for hot start PCR. This reagent contains all components for PCR except primers and template DNA. This reagent shows specific and efficient amplification. The amplified products can be directly loaded in the wells of agarose or acrylamide gels.
Features
Quick Taq® HS DyeMix contains bromophenol blue (BPB) as an electrophoresis dye; the PCR products can be analyzed directly with an agarose or acrylamide gel.
Enables greater PCR performance than conventional Taq DNA polymerase.
This reagent contains anti-Taq antibodies for hot start PCR. Hot start technology realizes highly specific and sensitive PCR.
Quick Taq® HS DyeMix is stable for at least three months at 4ºC. No decrease in reaction efficiency is observed following 30 freeze-thaw cycles.
Applications
For routine PCR in the lab only.
- Genotyping
- Colony PCR
- DNA Fingerprinting or routine Forensic PCR
- Template Verification PCR
- Validation of PCR bands
- Gene Expression Analyses
- Mutation Detection
- Routine Screening and High Throughput PCR
- Restriction Fragment Length Polymorphism (RFLP) Analyses
- Direct Genomic PCR
* Not high fidelity. NOT Recommend for PCR for sequencing and cloning purposes.
Components
This reagent includes the following components for 100 reactions, 50 µl total reaction volume:
2x Quick Taq® HS DyeMix 1.25ml× 2
*In the case of the long-term storage (>3 months), this reagent should be stored at -20ºC.
Typical PCR Reaction Setup
| Component | Volume | Final Concentration |
|---|---|---|
| Quick Taq® HS DyeMix | 25 µl | 1x |
| 10 pmol /µl Primer #1 | 1.0 µl | 0.2 µM |
| 10 pmol /µl Primer #2 | 1.0 µl | 0.2 µM |
| Template DNA | X µl | Genomic DNA ≤ 200 ng/50 µl Plasmid DNA ≤ 50 ng/50 µl Colony |
| PCR grade water | Y µl | |
| Total reaction volume | 50 µl |
* Do not use dNTPs from other kits or companies.
PCR Cycle Conditions

We recommend trying 3-step cycles when the Tm of primers is under 73ºC.
Application Data
Example 1. Amplification of the human p53 genes (2.9 kb)
The human p53 genes (2.9 kb) was amplified using 50 ng of human genomic DNA. Quick Taq® HS DyeMix successfully amplified the targets.

M: 1 kb Ladder
1: Quick Taq® HS DyeMix
2: rTaq DNA polymerase (hot start)
3: rTaq DNA polymerase
4: Taq Master Mix (Company A)
Template: Human genomic DNA 50 ng / 50 µl reaction
Forward Primer: AATGGATGATTTGATGCTGTCCC
Reverse Primer: ATAAGAGCTCCCAAGACTTAG
*Final concentration 0.2 µM
Example 2. Insert amplification by a colony-direct PCR
The inserts were amplified using Quick Taq® HS DyeMix with universal primers from E. coli DH5α colonies bearing pTA2 plasmid (insert size: 500 bp). Quick Taq® HS DyeMix successfully and efficiently amplified all targets.

Quick Taq® HS DyeMix — Performance Highlights
Feature:
Taq Master Mix + Loading Dye
From "No band" to "YES BAND" during Genotyping
Immediate Loading PCR after High Throughput Run
Robust PCR + Dye loading Save Time
Lowest Price in the Market keeping the better result

1. Mouse Ear Punch Genotyping: Quick Taq Master Mix can change from NO band to YES band and is far superior to Thermo Fisher Taq Polymerase+Buffer
Compared with "Thermo Fisher Scientific's Taq polymerase and Buffer"

Thermo Fisher Scientific's Taq polymerase and Buffer

With Diagnocine's Toyobo brand, "Quick Taq HS DyeMix"
From "No band" to "YES BAND" during Genotyping
40% to 80% Lower Cost than BioRad, Qiagen, Promega, and "Thermo Fisher Scientific" brands
Up to Ten Times greater Intensity than "Thermo Fisher Scientific" Taq Polymerase
Multipurpose Routine PCR
Colony and Multipurpose Screening
KnockOut, KnockIn, Transgenic, Mouse Tail, Large Scale High-throughput
2. Genomic DNA PCR: Quick Taq generates endpoint PCR bands 7 times brighter and thicker than Thermos Fisher Taq polymerase+buffer
TOYOBO "Quick Taq HS DyeMix" is superior to leading competitors
Diagnocine's Toyobo VS Thermo Fisher Scientific
3. Minimal sample PCR: Quick Taq Master Mix amplify at least 5 times better than Thermo Fisher Dream Taq
PCR of human IL-15cDNA and PCR of human IL-21cDNA

M : 1Kb Plus DNA Ladder
1. PCR of IL-15 + IL-21 using Green Dream Taq 2X MM (Thermo Fisher)
2. PCR of IL-15 + IL-21 using Quick Taq HSDyeMix (TOYOBO) Diagnocine
*Data kindly provided by NIAID/NIH lab
4. Mouse Tail Genotyping: Quick Taq Master Mix is more than 10 fold greater to produce sharp bands when compared to Thermos Fisher Taq 2X Master Mix
Genotyping Data, 2XMM
5. Quick Taq Master Mix generates clean and sharp heterogeneous two bands for genotyping
Genotyping results from mousetail
6. Transgenic Selection Tail Genotyping: Quick Taq Master Mix correctly identifies positive Transgenic Mice with 'Tough Template' PCR
The images show screenings of positive transgenic mice, of which you will see a sequencing result confirmed the specificity of DyeMix PCR result.
7. Mouse Tail Genotyping is easy and clean bands every time with Quick Taq Master Mix
Genotyping results
8. Routine colony screening; Quick Taq generates thicker and 3 times brighter PCR bands than Thermo Fisher Taq master mix
“Toyobo Quick Taq HS DyeMix is brighter and has a higher density than our lab’s Taq mix.”
Related Product
** Less than 10 min Mouse Genotyping and Routine Screening
On This Page
- 1. Mouse Ear Punch Genotyping: Quick Taq Master Mix can change from NO band to YES band and is far superior to Thermo Fisher Taq Polymerase+Buffer
- 2. Genomic DNA PCR: Quick Taq generates endpoint PCR bands 7 times brighter and thicker than Thermos Fisher Taq polymerase+buffer
- 3. Minimal sample PCR: Quick Taq Master Mix amplify at least 5 times better than Thermo Fisher Dream Taq
- 4. Mouse Tail Genotyping: Quick Taq Master Mix is more than 10 fold greater to produce sharp bands when compared to Thermos Fisher Taq 2X Master Mix
- 5. Quick Taq Master Mix generates clean and sharp heterogeneous two bands for genotyping
- 6. Transgenic Selection Tail Genotyping: Quick Taq Master Mix correctly identifies positive Transgenic Mice with 'Tough Template' PCR
- 7. Mouse Tail Genotyping is easy and clean bands every time with Quick Taq Master Mix
- 8. Routine colony screening; Quick Taq generates thicker and 3 times brighter PCR bands than Thermo Fisher Taq master mix






